Summary: Antisense oligonucleotides: from tools in molecular genetics to therapeutic agents. The binding of an oligodeoxynucleotide so-called anti-sense
Evaluation of 2'-modified oligonucleotides containing. 2'-deoxy gaps as antisense inhibitors of gene expression. J Biol Chem 1 993 ; 268 : 1 451 4-22. Depuis
5 juin 2018 de synthétiser un brin d'acide nucléique un oligonucléotide antisens (ASO)
antisense oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT) for treatment of neovascular glaucoma. On 2 October 2003 orphan designation (EU/3/03/161) was granted
Antisense oligonucleotide of apolipoprotein C-III: new treatment of certain Apolipoproteine C-III - Oligonucléotide antisens.
24 avr. 2012 USA Ltd United Kingdom
3 avr. 2019 Thérapie génique non intégrative par oligonucléotide antisens adressé par peptides bifonctionnels RTf1-CPP. Soutenue Par. Arienne MIRMIRAN.
28 juin 2021 A randomized placebo-controlled phase 3 trial of an antisense oligonucleotide drisapersen
17 oct. 2017 Antisens OligoNucleotide. ARN. Acide RiboNucléique. ASDS. ASO. BACHD. BDNF. BHE. Sites Accepteurs et Donneurs. Antisense Oligonucleotide.
systémique fut l'oligonucléotide antisens des anticorps des inhibiteurs des ARNm (oligonucléotides anti-sens et small interfering RNA(siRNA))