Data Objects and Attribute Types • Basic Statistical Descriptions of
Note that quantitative attributes can be integer-valued or continuous. – Numeric operations such as mean standard deviation are meaningful. Data Mining.
Mining Quantitative Association Rules in a Atherosclerosis Dataset
Keywords: data mining association rule
Optimal Subgroup Discovery in Purely Numerical Data
27 janv. 2021 Mining purely numerical data is quite popular. It concerns data made of objects described by numerical attributes and one of these attributes ...
DB-HReduction: A Data Preprocessing Algorithm for Data Mining
time the data are collected without “mining” in mind. In addition
1 CLUSTERING LARGE DATA SETS WITH MIXED NUMERIC AND
Another characteristic is that data in data mining often contains both numeric and categorical values. The traditional way to treat categorical attributes as
Numerical Association Rule Mining from a Defined Schema Using
2 juil. 2021 Keywords: association rules; data mining; ... encompasses numerical attributes in the search process for patterns through rules in the data.
Mining Optimized Association Rules for Numeric Attributes
algorithms that compute the optimized ranges in linear time if the data are sorted. Since sorting data with respect to each numeric attribute is.
LATEX-Numeric: Language Agnostic Text Attribute Extraction for
11 juin 2021 We rely on dis- tant supervision for training data generation removing dependency on manual labels. One issue with distant supervision is that ...
Optimal Subgroup Discovery in Purely Numerical Data
27 janv. 2021 Mining purely numerical data is quite popular. It concerns data made of objects described by numerical attributes and one of these attributes ...
1992-ChiMerge: Discretization of Numeric Attributes
Many classification algorithms require that the training data contain only discrete attributes. To use such an algorithm when there are numeric at-.
Data Mining and Machine Learning: Fundamental Concepts and
Chapter 2: Numeric Attributes Zaki & Meira Jr (RPI and UFMG) Data Mining and Machine Learning Chapter 2: Numeric Attributes 1/35 Univariate Analysis Univariate analysis focuses on a single attribute at a time The data matrix D is an n×1 matrix D = X x 1 x 2 x n where X is the numeric attribute of interest with x
Describe the different types of attributes one may come across in a
01/27/2021 Introduction to Data Mining 2nd Edition 18 Tan Steinbach Karpatne Kumar Data Matrix ˜ If data objects have the same fixed set of numeric attributes then the data objects can be thought of as points in a multi-dimensional space where each dimension represents a distinct attribute
Data Mining and Analysis - Cambridge
numeric attribute is one that has a real-valued or integer-valued domain ForexampleAgewithdomain(Age) =NwhereNdenotes the set of natural numbers(non-negative integers) is numeric and so is petal length in Table 1 1 withdomain(petal length)=R+(the set of all positive real numbers)
Data Mining - University of Waikato
We will focus on nominal and numeric ones Data Mining: Practical Machine Learning Tools and Techniques (Chapter 2) 4 What’s a concept? Styles of learning: Classification learning: predicting a discrete class Association learning: detecting associations between features Clustering: grouping similar instances into clusters
Data Mining: Data - Khoury College of Computer Sciences
There are different types of attributes –Nominal uExamples: ID numbers eye color zip codes –Ordinal uExamples: rankings (e g taste of potato chips on a scale from 1-10) grades height in {tall medium short} –Interval uExamples: calendar dates temperatures in Celsius or Fahrenheit –Ratio
Searches related to numeric attributes in data mining filetype:pdf
There are a variety of statistical techniques available to analyse quantitative (numeric) data sets In this case we have selected to use Principal Components Analysis (PCA) to reduce the dimensionality of our data and Growing Neural Gas (GNG) to identify potentially interesting clusters of data
[PDF] Data Objects and Attribute Types • Basic Statistical Descriptions of
A collection of attributes describe an object • Attribute values are numbers or symbols assigned to an attribute Data Mining
[PDF] Data Lecture Notes for Chapter 2 Introduction to Data Mining 2nd
27 jan 2021 · Introduction to Data Mining 2nd Edition Tan Steinbach Karpatne Kumar Attribute Values Attribute values are numbers or symbols
[PDF] Data Mining - University of Waikato
Attributes: measuring aspects of an instance We will focus on nominal and numeric ones 4 Data Mining: Practical Machine Learning Tools and Techniques
[PDF] Data Mining
There are different types of attributes – Nominal:Examples: ID numbers eye color zip codes – Ordinal: Examples: rankings (e g taste of potato
[PDF] Data Mining Input: Concepts Instances Attributes and Pre
Numeric attributes have values that come from a range of numbers attribute possible values Body Temp any value in 96 0-106 0 Salary any value in $15000
[PDF] Basic Data Mining Techniques
Attributes Objects Data Mining Lecture 2 4 Attribute Values • Attribute values are numbers or symbols assigned to an attribute
[PDF] Know Your Data
In our presentation we have organized attributes into nominal binary ordinal and numeric types There are many ways to organize attribute types The types
[PDF] Data Chapter 2 Introduction to Data Mining
Data Mining: Data Chapter 2 Attribute values are numbers or symbols assigned to an attribute Different attributes can be mapped to the same set of
[PDF] 22 Chapter 2 Data
In turn data objects are described by a number of attributes that capture the basic characteristics of an object such as the mass of a physical object or the
[PDF] LECTURE NOTES ON DATA MINING& DATA WAREHOUSING
A user does not want hundreds of pages of numeric results He does not understand them; he cannot summarize interpret and use them for successful decision
What are the different types of attributes in data mining?
- Describe the different types of attributes one may come across in a data mining data set with two examples of each type. The values of a nominal attribute are just different names, i.e. nominal attributes provide only enough information to distinguish one object from another (=,?) Examples: zip codes, employees ID numbers.
What are the characteristics of a data mining algorithm?
- Data mining algorithms are often sensitive to specific characteristics of the data: outliers (data values that are very different from the typical values in your database), irrelevant columns, columns that vary together (such as age and date of birth), data coding, and data that you choose to include or exclude.
What is attribute importance in Oracle Data Mining?
- Oracle Data Mining supports the Attribute Importance mining function, which ranks attributes according to their importance in predicting a target. Attribute importance does not actually perform feature selection since all the predictors are retained in the model.
What is a numeric attribute?
- A numeric attribute is quantitative; that is, it is a measurable quantity, represented in integer or real values. Numeric attributes can be interval-scaled or ratio-scaled. Photo by Luke Chesseron Unsplash What are interval-scaled attributes? A temperature attribute is interval-scaled.
01/27/20211Introduction to Data Mining, 2nd Edition
Tan, Steinbach, Karpatne, Kumar
Data Mining: Data
Lecture Notes for Chapter 2
Introduction to Data Mining , 2
ndEdition
byTan, Steinbach, Kumar
01/27/20212Introduction to Data Mining, 2nd Edition
Tan, Steinbach, Karpatne, Kumar
Outline
Attributes and Objects
Types of Data
Data Quality
Similarity and Distance
Data Preprocessing
1 2What is Data?
Collection of data objects
and their attributesAn attributeis a property
or characteristic of an object -Examples: eye color of a person, temperature, etc. -Attribute is also known as variable, field, characteristic, dimension, or featureA collection of attributes
describe an object -Object is also known as record, point, case, sample, entity, or instanceTid Refund Marital
Status
Taxable
Income
Cheat1 Yes Single 125K No
2 No Married 100K No
3 No Single 70K No
4 Yes Married 120K No
5 No Divorced 95K Yes
6 No Married 60K No
7 Yes Divorced 220K No
8 No Single 85K Yes
9 No Married 75K No
10 No Single 90K Yes
10Attributes
Objects
01/27/20214Introduction to Data Mining, 2nd Edition
Tan, Steinbach, Karpatne, Kumar
Attribute Values
Attribute valuesare numbers or symbols
assigned to an attribute for a particular object Distinction between attributes and attribute values -Same attribute can be mapped to different attribute valuesExample: height can be measured in feet or meters
-Different attributes can be mapped to the same set of values Example: Attribute values for ID and age are integers -But properties of attribute can be different than the properties of the values used to represent the attribute 3 4Measurement of Length
The way you measure an attribute may not match the attributes properties. 1 2 3 557 8 15 10 4A B C D E
This scale
preserves the ordering and additvity properties of length.This scale preserves only the ordering property of length.01/27/20216Introduction to Data Mining, 2nd Edition
Tan, Steinbach, Karpatne, Kumar
Types of Attributes
There are different types of attributes
-NominalExamples: ID numbers, eye color, zip codes
-Ordinal Examples: rankings (e.g., taste of potato chips on a scale from 1-10), grades, height {tall, medium, short} -Interval Examples: calendar dates, temperatures in Celsius orFahrenheit.
-RatioExamples: temperature in Kelvin, length, counts,
elapsed time (e.g., time to run a race) 5 601/27/20217Introduction to Data Mining, 2nd Edition
Tan, Steinbach, Karpatne, Kumar
Properties of Attribute Values
The type of an attribute depends on which of the following properties/operations it possesses: -Distinctness: = -Order: < > -Differences are+ - meaningful : -Ratios are meaningful -Nominal attribute: distinctness -Ordinal attribute: distinctness & order -Interval attribute: distinctness, order & meaningful differences -Ratio attribute: all 4 properties/operations01/27/20218Introduction to Data Mining, 2nd Edition
Tan, Steinbach, Karpatne, Kumar
Difference Between Ratio and Interval
Is it physically meaningful to say that a
temperature of 10 °is twice that of 5°on -the Celsius scale? -the Fahrenheit scale? -the Kelvin scale?Consider measuring the height above average
-If Bill's height is three inches above average and Bob's height is six inches above average, then would we say that Bob is twice as tall as Bill? -Is this situation analogous to that of temperature? 7 8Attribute
TypeDescription
Examples
Operations
Nominal
Nominal attribute
values only distinguish. (=, ) zip codes, employeeID numbers, eye
color, sex: {male, female} mode, entropy, contingency correlation, 2 testCategorical
Qualitative
Ordinal Ordinal attribute
values also order objects. (<, >) hardness of minerals, {good, better, best}, grades, street numbers median, percentiles, rank correlation, run tests, sign testsInterval For interval
attributes, differences between values are meaningful. (+, - ) calendar dates, temperature inCelsius or Fahrenheit mean, standard
deviation,Pearson's
correlation, t andF tests
Numeric
Quantitative
Ratio For ratio variables,
both differences and ratios are meaningful. (*, /) temperature in Kelvin, monetary quantities, counts, age, mass, length, current geometric mean, harmonic mean, percent variation This categorization of attributes is due to S. S. StevensAttribute
TypeTransformation
Comments
Categorical
Qualitative
Nominal
Any permutation of values
If all employee ID numbers
were reassigned, would it make any difference?Ordinal An order preserving change of
values, i.e., new_value = f(old_value) where f is a monotonic functionAn attribute encompassing
the notion of good, better best can be represented equally well by the values {1, 2, 3} or by { 0.5, 1, 10}.Numeric
Quantitative
Interval new_value = a * old_value + b
where a and b are constants Thus, the Fahrenheit andCelsius temperature scales
differ in terms of where their zero value is and the size of a unit (degree).Ratio new_value = a * old_value
Length can be measured in
meters or feet. This categorization of attributes is due to S. S. Stevens 9 1001/27/202111Introduction to Data Mining, 2nd Edition
Tan, Steinbach, Karpatne, Kumar
Discrete and Continuous Attributes
Discrete Attribute
-Has only a finite or countably infinite set of values -Examples: zip codes, counts, or the set of words in a collection of documents -Often represented as integer variables. -Note: binary attributesare a special case of discrete attributesContinuous Attribute
-Has real numbers as attribute values -Examples: temperature, height, or weight. -Practically, real values can only be measured and represented using a finite number of digits. -Continuous attributes are typically represented as floating- point variables.01/27/202112Introduction to Data Mining, 2nd Edition
Tan, Steinbach, Karpatne, Kumar
Asymmetric Attributes
Only presence (a non-zero attribute value) is regarded as importantWords present in documents
Items present in customer transactions
If we met a friend in the grocery store would we ever say the following? "I see our purchases are very similar since we didn't buy most of the same things." 11 1201/27/202113Introduction to Data Mining, 2nd Edition
Tan, Steinbach, Karpatne, Kumar
Critiques of the attribute categorization
Incomplete
-Asymmetric binary -Cyclical -Multivariate -Partially ordered -Partial membership -Relationships between the dataReal data is approximate and noisy
-This can complicate recognition of the proper attribute type -Treating one attribute type as another may be approximately correct01/27/202114Introduction to Data Mining, 2nd Edition
Tan, Steinbach, Karpatne, Kumar
Key Messages for Attribute Types
The types of operations you choose should be "meaningful" for the type of data you have-Distinctness, order, meaningful intervals, and meaningful ratios are only four (among many possible) properties of data
-The data type you see - often numbers or strings - may not capture all the properties or may suggest properties that are not present
-Analysis may depend on these other properties of the data Many statistical analyses depend only on the distribution -In the end, what is meaningful can be specific to domain 13 1401/27/202115Introduction to Data Mining, 2nd Edition
Tan, Steinbach, Karpatne, Kumar
Important Characteristics of Data
-Dimensionality (number of attributes) High dimensional data brings a number of challenges -SparsityOnly presence counts
-ResolutionPatterns depend on the scale
-SizeType of analysis may depend on size of data
01/27/202116Introduction to Data Mining, 2nd Edition
Tan, Steinbach, Karpatne, Kumar
Types of data sets
Record
-Data Matrix -Document Data -Transaction Data Graph -World Wide Web -Molecular StructuresOrdered
-Spatial Data -Temporal Data -Sequential Data -Genetic Sequence Data 15 1601/27/202117Introduction to Data Mining, 2nd Edition
Tan, Steinbach, Karpatne, Kumar
Record Data
Data that consists of a collection of records, each of which consists of a fixed set of attributesTid Refund Marital
Status
Taxable
Income
Cheat1 Yes Single 125K No
2 No Married 100K No
3 No Single 70K No
4 Yes Married 120K No
5 No Divorced 95K Yes
6 No Married 60K No
7 Yes Divorced 220K No
8 No Single 85K Yes
9 No Married 75K No
10 No Single 90K Yes
1001/27/202118Introduction to Data Mining, 2nd Edition
Tan, Steinbach, Karpatne, Kumar
Data Matrix
If data objects have the same fixed set of numeric attributes, then the data objects can be thought of as points in a multi-dimensional space, where each dimension represents a distinct attribute Such a data set can be represented by an mby nmatrix, where there are mrows, one for each object, and n columns, one for each attribute1.12.216.226.2512.651.22.715.225.2710.23Thickness LoadDistanceProjection
of y loadProjection of x Load1.12.216.226.2512.651.22.715.225.2710.23Thickness LoadDistanceProjection of y loadProjection of x Load 17 1801/27/202119Introduction to Data Mining, 2nd Edition
Tan, Steinbach, Karpatne, Kumar
Document Data
Each document becomes a 'term' vector
-Each term is a component (attribute) of the vector -The value of each component is the number of times the corresponding term occurs in the document.01/27/202120Introduction to Data Mining, 2nd Edition
Tan, Steinbach, Karpatne, Kumar
Transaction Data
A special type of data, where
-Each transaction involves a set of items. -For example, consider a grocery store. The set of products purchased by a customer during one shopping trip constitute a transaction, while the individual products that were purchased are the items. -Can represent transaction data as record dataTID Items
1 Bread, Coke, Milk
2 Beer, Bread
3 Beer, Coke, Diaper, Milk
4 Beer, Bread, Diaper, Milk
5 Coke, Diaper, Milk
19 2001/27/202121Introduction to Data Mining, 2nd Edition
Tan, Steinbach, Karpatne, Kumar
Graph Data
Examples: Generic graph, a molecule, and webpages
5 2 1 2 5Benzene Molecule: C6H6
01/27/202122Introduction to Data Mining, 2nd Edition
Tan, Steinbach, Karpatne, Kumar
Ordered Data
Sequences of transactions
An element of
the sequenceItems/Events
2122
01/27/202123Introduction to Data Mining, 2nd Edition
Tan, Steinbach, Karpatne, Kumar
Ordered Data
Genomic sequence data
GGTTCCGCCTTCAGCCCCGCGCC
CGCAGGGCCCGCCCCGCGCCGTC
GAGAAGGGCCCGCCTGGCGGGCG
GGGGGAGGCGGGGCCGCCCGAGC
CCAACCGAGTCCGACCAGGTGCC
CCCTCTGCTCGGCCTAGACCTGA
GCTCATTAGGCGGCAGCGGACAG
GCCAAGTAGAACACGCGAAGCGC
quotesdbs_dbs20.pdfusesText_26[PDF] numerical analysis 1 pdf
[PDF] numerical analysis book for bsc
[PDF] numerical analysis book pdf by b.s. grewal
[PDF] numerical analysis book pdf by jain and iyengar
[PDF] numerical analysis books indian authors
[PDF] numerical analysis bsc 3rd year
[PDF] numerical analysis handwritten notes pdf
[PDF] numerical analysis pdf download
[PDF] numerical analysis pdf for computer science
[PDF] numerical analysis pdf s.s sastry
[PDF] numerical analysis pdf sauer
[PDF] numerical analysis pdf solutions
[PDF] numerical analysis questions and answers pdf
[PDF] numerical mathematical analysis pdf