Analysis and update of the human aldehyde dehydrogenase (ALDH









ALDH1L2 Knockout in U251 Glioblastoma Cells Reduces Tumor

30 avr. 2022 The knockout of ALDH1L2 gene in U251 cells rendered the growth of the cancer stem cells of U251 methionine independent.


ALDH1L2 Knockout in U251 Glioblastoma Cells Reduces Tumor

30 avr. 2022 The knockout of ALDH1L2 gene in U251 cells rendered the growth of the cancer stem cells of U251 methionine independent.


Deleterious mutations in ALDH1L2 suggest a novel cause for neuro

18 sept. 2019 We provide evidence that the neuro-ichthyotic syndrome in this case is associated with the loss of expression of the ALDH1L2 gene which encodes ...


Aldh1l2 knockout mouse metabolomics links the loss of the

The two enzymes are products of different genes with mitochondrial. ALDH1L2 appearing as the result of gene duplication during vertebrate evolution; the event 
s





Supplemental Methods

For each isolated clone ALDH1L2 gene deletion was evaluated by targeted sanger sequencing. In brief


Analysis and update of the human aldehyde dehydrogenase (ALDH

The aldehyde dehydrogenase (ALDH) gene superfamily encodes enzymes that are critical for The ALDH1L2 gene encodes a protein that is 72.3 per cent.


Gene symbol Forward Primer (5' –> 3') Reverse Primer (5' –> 3

Gene symbol. Forward Primer (5' –> 3') ALDH1L2. TAACACATACAACAAGACAGAT. ATATTCATTTAGAGCTTCCTCA ... Log 2 Fold change Top 50 upregulated genes.


Enzymatic properties of ALDH1L2 a mitochondrial 10

14 janv. 2011 of FDH (mtFDH) which is the product of a separate gene
s . S main ?sequence=





Cobalamin Deficiency Results in Increased Production of Formate

12 mars 2018 Gene expression analysis showed that 10-formyltetrahydrofolate dehydrogenase—cytosolic (Aldh1l1) and mitochondrial (Aldh1l2) expression were ...
nxx


Reversal of Cytosolic One-Carbon Flux Compensates for Loss of the

30 oct. 2015 gulated are two genes of mitochondrial 1C transformations: ... duce mitochondrial NADPH via the enzyme ALDH1L2 and.
S ( )


248282